Skip to main content

Table 9 Primer sequence and allele information for STRs in the DLA region of Poodles

From: The effect of genetic bottlenecks and inbreeding on the incidence of two major autoimmune diseases in standard poodles, sebaceous adenitis and Addison’s disease

  ID Forward primer Reverse primer # Allele Size range
DLA-I 3CCA TGTACTTGAACACTCCCTGCAC CCTCACATAGCCCTTCTCAGC 14 375–393
  4ACA CAAAGGAAAGCCTTTGAGTTCG GCTGGGCCCATACCTCATCT 12 364–381
  4BCT ATGCCAGAGGTTGGAGCATT GGAGCAGAGAAAACAAGCGAAT 6 277–293
  1131 TTGTGCCCTCAGGAAAAACC GGGGCATTGTGGAGTAGAGC 9 178–188
DLA-II 5ACAa TATTGCACCCTGGTGTCTGC GTTTCTT TTGCCCTGGGTGGTAAAATC 6 339–351
  5ACTa GGAACCCCCTGTAAAATTTCTT GTTTCTT CAGCCAAGACCTTAGGAGCAA 7 321–329
  5BCAa GTTTCTT CCCTGGATATGTGGCAGTCA TGCCCTCTTCCACTTCACCT 6 268–288
  1. aThese primers have 7 bp pigtails