Skip to main content

Advertisement

Table 1 Primers designed for SLC24A4 gene amplification and sequencing

From: An autosomal recessive mutation in SCL24A4 causing enamel hypoplasia in Samoyed and its relationship to breed-wide genetic diversity

Exon Prod.(bp) Forward primer 5′-3’ Reverse primer 5′-3’
1 908 CCAAATCAGGGAGCCTCAGAG GTTCTTGCCTGGGCGTGAG
2 388 GTATCACTCCCTACAGGTGGCTCTA TACCTTCCGTGCCTTACAGCC
3 641 GGTGGCTAATCCAGCGTTCG GCATCATGGGAATCACGACAGT
4 529 CCGCTGCTGCTTAGAGATGC GGAAGCACCTGTCCTCAGAAGC
5–7 1669 ACAGGGGACTCGGGCTGA GTGCTGTGGGTTCTCTGGTCA
8 555 GTAGGCAGGTGCGTAGGGACA AGGAGCACTGAGGAAACCATCTG
9–10 1916 GGGCTTCAGATGGCAGGATG GGATGGCAGGTGAGAGTGAGG
11 648 TCAGGATGGGCTCAGCAAGAG GGGGCAGGACTGGATTGAGG
12 617 GCAAACTTAGAGGGATGGTGAGG TCAAACTACGGGTGATGTGTGG
13 506 GGGTGACATTATGGAGGTGTGTG CCACACACCTCTGCTGAAACC
14 677 GCTGTCCTGAATCAGAACCTGG GCTTTGTTCAATGTCACACTGGTG
15–16 1017 AGTCCTCTGTGGAGAGCAGCG AACAATGGACGGGTCGGTG
17 599 GCAGCAGCCATGTGTCCTG GAGGGCAGGGCTCCGAG
6 sa   GGCTGTGCTGAAACCCTGG  
16 sa   GCACTAGGCTCTGAGAACACTGC  
  1. a6s and 16 s are additional primers required for sequencing of the large exons 6 and 16