Skip to main content

Table 2 5′ UTR microsatellite repeat length diversity, sequence and occurrence observed in dog (D), wolf (W), and coyote (C)

From: Single nucleotide polymorphisms and microsatellites in the canine glutathione S-transferase pi 1 (GSTP1) gene promoter

Repeat unit Sequence VAR score dG (kcal/mol) D W C
10 GCT(GCC)7ACCGCC 0.58 −5.6 0.007 0.000 0.286
11 GCT(GCC)8ACCGCC 0.75 −8.5 0.099 0.000 0.000
12*1 GCT(GCC)9ACCGCC 0.88 −9.5 0.000 0.040 0.000
12*2 GCT(GCC)3GCTGCCACTGCTACCGCCACCGCC 0.72 −4.8 0.000 0.000 0.286
13 GCT(GCC)10ACCGCC 0.97 −11.5 0.000 0.180 0.000
14 GCT(GCC)13 1.09 −14.5 0.013 0.000 0.000
15 GCT(GCC)14 1.12 −17.5 0.005 0.000 0.000
16*1 GCT(GCC)15 1.13 −17.5 0.302 0.140 0.000
16*2 GCT(GCC)3GCTGCCACTGCTACC(GCC)3ACCGCCACCGCC 0.58 −7.3 0.124 0.000 0.143
17 GCT(GCC)5GCT(GCC)8ACCGCC 1.10 −14.4 0.424 0.214 0.143
18 GCT(GCC)5GCT(GCC)9ACCGCC 1.10 −18.0 0.009 0.285 0.000
19 GCT(GCC)5GCT(GCC)6ACCGCCACCGCCACCGCC 1.07 −14.4 0.013 0.000 0.000
20 GCT(GCC)3GCTGCCACTGCTACC(GCC)3ACC(GCC)3ACCGCCACCGCC −11.4 0.000 0.140 0.143
22*1 GCT(GCC)3GCTGCAACTGCTACC(GCC)3ACTGCTACC(GCC)3ACCGCCACCGCC 0.64 −11.0 0.002 0.000 0.000
22*2 GCT(GCC)3GCTGCAACTGCTACC(GCC)2ACTGCTACC(GCC)4ACCGCCACCGCC −13.3 0.002 0.000 0.000
  1. Sequences shown are 5′ → 3′ on the (−) strand. The SERV VARScore refers to the consensus GCC sequence. Computed Gibbs’ energy contributions (dG) shown are for the most stable RNA secondary structure motif only