Skip to main content

Advertisement

Table 3 List of primer used for analysis of the canine CMAH gene

From: Molecular characterization of cytidine monophospho-N-acetylneuraminic acid hydroxylase (CMAH) associated with the erythrocyte antigens in dogs

AmpliconPrimer namePrimer sequences (5′-3′)Location*Annealing (°C/s)Predicted product size (bp)Genbank Accession No., [Ref]
cDNA cloning
 Fragment 1dCMAH-cE1aFCTGTTTTGTGCAGTTTGGCCTCTTexon 1 (5′-UTR)*55/601146[30]
dCMAH-cE9RTTGTCTGATGGATGGGATTCCACAexon 9  NC_006617.3
 Fragment 2dCMAH-cE8FCCTGAGAAGGTTGCTCTAATGAexon 8*55/60925NC_006617.3
cDMAH-cE15RTGATCAAGATGTAGCGTCAGTAAATexon 15 (3′-UTR)  NC_006617.3
 Fragment 3dCMAH-cE1aFCTGTTTTGTGCAGTTTGGCCTCTTexon 1 (5′-UTR)*55/1801852[30]
cDMAH-cE15RTGATCAAGATGTAGCGTCAGTAAATexon 15 (3′-UTR)  NC_006617.3
SNP discovery
  Fragment 1dCMAH-gE1FCTCCAGGCTGCCGTCCTTCTAPromoter*55/30227NC_006617.3
dCMAH-gE1RCAACAGCTTTCAGTTCTTGAATintron 1  NC_006617.3
 Fragment 2dCMAH-gE2FGCCTGGATACTTGGAGGGAGGintron 1*55/30393NC_006617.3
dCMAH-gE2RTGATCAGAGAGATGTCCTAAGTintron 2  NC_006617.3
 Fragment 3dCMAH-gE3FAGTATTATCTCCTAATGGTTTintron 2*55/30369NC_006617.3
dCMAH-gE3RAAGTCCGACTCTACACAGTTTintron 3  NC_006617.3
 Fragment 4dCMAH-gE4FTGAGTTGGTGTTGGTCTTAAGintron 3*55/30483NC_006617.3
dCMAH-gE4RTCCTAAGAAATTTGCTTAATAGintron 4  NC_006617.3
 FragmentdCMAH-gE5FTTGAGCATTCTTAGAAGCGAAintron 4*55/30500NC_006617.3
dCMAH-gE5RCCTCACTCTGAGTGGTATATAintron 5  NC_006617.3
 Fragment 6dCMAH-gE6FAATTCCTTGCTTCTTGATCAACAintron 5*55/30334NC_006617.3
dCMAH-gE6RATCTTAAAGTAACTACCTCATCTACintron 6  NC_006617.3
 Fragment 7dCMAH-gE7FGAAGGATTTCTTTCCAGATGAGCintron 6*55/30254NC_006617.3
dCMAH-gE7RCAGATGGCTGTTATCACCCTTintron 7  NC_006617.3
 Fragment 8dCMAH-gE8FGGACATAAGTGATGCTTCTCTAintron 7*55/30445NC_006617.3
dCMAH-gE8RGGCGCTAAACCACTAAGCCACintron 8  NC_006617.3
 Fragment 9dCMAH-gE9FTTCCTGTGTTAGTCTATCCATintron 8*55/30386NC_006617.3
dCMAH-gE9RAAGCTCCGTGCTCTCAGGCAGintron 9  NC_006617.3
 Fragment 10dCMAH-gE10FTAAGTGGATAGGATTGTGAAGintron 9*55/30373NC_006617.3
dCMAH-gE10RCCTACAAATAAGGACTTGTCAintron 10  NC_006617.3
 Fragment 11dCMAH-gE11FGATAAGAGAACTTTCCTGTATintron 10*55/30433NC_006617.3
dCMAH-gE11RTCCGTGAAGCAGTTGGTAGCGintron 11  NC_006617.3
 Fragment 12dCMAH-gE12FCATTGCTATCAATTAAGGCTGintron 11*55/30360NC_006617.3
dCMAH-gE12RGTAAAGTAAGGTGTTAACAATintron 12  NC_006617.3
 Fragment 13dCMAH-gE13FAGCCTGTCATATCTACTCCATintron 12*55/30393NC_006617.3
dCMAH-gE13RGAAATGAAGCCCTAATGGTGGintron 13  NC_006617.3
 Fragment 14dCMAH-gE14FCAGTATGGAAGCACCATCTCTintron 13*55/30353NC_006617.3
dCMAH-gE14RATGTTCTTGCAATGTTAGCTCintron 14  NC_006617.3
mRNA expression
 CMAHdCMAH-cE2FTGTGCAAGCATCAAGGAGGCexon 2*55/30342NC_006617.3
dCMAH-cE4RAGGCAGGACCTATTAACCAGexon 4  NC_006617.3
 GAPDHdGAPDH-cE1/2CACAGTCAAGGCTGAGAACGexon 1/2*55/30101[37]
dGAPDH-cE2CACCAGCATCACCCCATTTexon 2  [37]
  1. Number of exon is detemined by comaparison between Ac. No. LC382414 and NC_006617.3 in this study
  2. NC_006617.3: Canis lupus familiaris breed boxer chromosome 35, CanFam3.1, whole genome shotgun sequence
  3. d dog, E: exon, F Forward primer, R reverse primer, number exon number, c designed, g designed from genomic sequence in primer name